Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator RbsR2 in Staphylococcaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Regulog: RbsR2 - Staphylococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Staphylococcus aureus subsp. aureus N315
SA0260 rbsU -88 4.5 TTATGAAAACGCATGCATTT
Staphylococcus epidermidis ATCC 12228
SE2088 rbsU -270 4.7 GTAGGTAACCGTTAAAATAA
Staphylococcus carnosus subsp. carnosus TM300
Sca_2421 rbsU -103 5.4 ATATGAAAGCGTATACATAT
Staphylococcus haemolyticus JCSC1435
SH0174 rbsR2 -33 6.6 TCATGTAAGCGGTTACATAA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
SSP1396 rbsR2 -32 6.4 ATATGAAAACGGTTACATAA
SSP1395 rbsD -35 6.7 TTATGTAACGGGTTACATAT
Macrococcus caseolyticus JCSC5402
MCCL_0348 rbsR2 -36 6.6 TTATGTAATCGGTTACACAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD