Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CymR in Clostridia-1

Properties
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector:
Regulog: CymR - Clostridia-1
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clostridium acetobutylicum ATCC 824
CAC0102 metY -77 5 CATTACATAGTAAAGTAATATGTTTTA
CAC2235 cysK -49 5.8 ATATTCCTAGTAAACAAATGTGTTTAA
CAC0102 metY -277 5.7 ATATTCATATTAATATAGTAGGAATTA
CAC0878 CAC0878 -70 5.8 TTAAACATATTAGTTTAGTAGGTATTT
CAC0929 ubiG -473 5.4 AAAAACCTACTTATCAGATATGAAAAA
CAC2236 cymR -86 5.3 AAAATTCTACTTGACAAGTAAAATTTT
CAC3325 CAC3325 -354 5.6 GTATACCTACTTGTATACTAGGAATAT
Clostridium beijerincki NCIMB 8052
Cbei_4193 sbpA -98 5.8 AAAATCCTACTAAACATATATGAATAT
Cbei_4194 sbpA -170 5.3 TAATTCCCATTGAAATAATAGGAATTA
Cbei_4344 tcyP -48 5.3 ATAAATATACTAATTATATAGGAATTG
Cbei_0629 mccB -140 5.7 TAAAACACAGTAAACAAATAAGAATAA
Clostridium botulinum A str. ATCC 3502
CBO1179 cysK -303 5.9 GAATACCTAGTAAACAAATAAGAATAA
CBO1178 cymR -45 5.7 ATAATCATAGTAAATAGATAGGAATAC
Clostridium butyricum 5521
CBY_1162 mccB -100 5.5 TAATTCCAAGTAAACAAATAGTAATAG
CBY_3239 cysT -81 5.6 TAATTCATAGTAATTCTATAAGAATAA
Clostridium tetani E88
CTC01344 cymR -40 5.8 ATAATCATACTAAACATATAGGAATAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD