Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IscR in Clostridia-3

Properties
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Clostridia-3
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Blautia hansenii DSM 20583
BLAHAN_03017 iscR -43 5.6 AGAAATCAGAGTAAAACAGTCGGAATTGA
Bryantella formatexigens DSM 14469
BRYFOR_01246 iscR -53 6.2 AGAAATCCGAGTAATTTAGTAGGATTTAA
Clostridium nexile DSM 1787
CLONEX_03012 iscR -51 5.9 ATAAACCCTAGTAATTCACTAGGAATTAA
Clostridium scindens ATCC 35704
CLOSCI_01399 iscR 18 5.7 AGAAATCCTAGCAAATTGCTAGGAATTAA
Dorea formicigenerans ATCC 27755
DORFOR_01426 iscR -37 4.7 TAAATCCCCAGTATTTTGCTAGGGATTGG
Dorea longicatena DSM 13814
DORLON_02444 iscR -43 5.4 AAAAATCCTAGTAAAATACTGGGGATTAA
Eubacterium rectale ATCC 33656
EUBREC_0307 iscR -45 5.3 TGAATGTATAGTAAAGCAGTAGGAAATGA
Ruminococcus gnavus ATCC 29149
RUMGNA_01751 iscR -60 4.5 GGAAATCCTAGTAAAACAATAGGGATTGG
Ruminococcus lactaris ATCC 29176
RUMLAC_01913 iscR -54 4.6 GAAAATCCTAGTACAATACTAGGGATAAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD