Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IscR in Clostridia-2

Properties
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Clostridia-2
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clostridium bartlettii DSM 16795
CLOBAR_02189 iscR -88 5.7 TTAATGTTGACAAAAACACTCAAGTATAA
CLOBAR_02189 iscR -113 6.6 TTAATTCTGACTAAAATAGTCAAAATTAA
Clostridium difficile 630
CD1278 iscR -53 5.4 GTAATTCCTACTAAAACAGTATGAATTAG
CD1278 iscR -98 6 TTAATCTTGACAAAATTAGTAGGGTATAA
Clostridium hiranonis DSM 13275
CLOHIR_01195 iscR -43 6 TTAAACCATAGTAAAACAGTAGGAATTAA
CLOHIR_01195 iscR -77 5.7 TAATACTTGACAAAAATAGTCGGATATAA
CLOHIR_01195 iscR -103 5.9 ACAAATCATACTAAAATAGTAGGAAATAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD