Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IscR in Clostridia-1

Properties
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Clostridia-1
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clostridium acetobutylicum ATCC 824
CAC1675 iscR -41 5.8 ACAAAGTAGAGTATTATTGTCGGAATTAA
CAC3288 sufC -58 5.4 TGAATTCCGACTTAAATGGTCAAGATTAA
Clostridium beijerincki NCIMB 8052
Cbei_4356 cysK -55 5.2 TTATAACATAGTAAACTGATAAGAATTAT
Cbei_1097 iscR -105 5.7 CAAAAGCCGAGTATTTTGGTAAGATATAA
Clostridium botulinum A str. ATCC 3502
CBO2569 iscR -43 6 ATAAATCATAGTAAAGTGGTCAACATTAA
CBO2569 iscR -82 4.8 ATATTGTTGACAGGTTTAGTCTGATTTGC
Clostridium butyricum 5521
CBY_2622 iscR -61 5.3 CAATAGCCGAGTATTTTGATAAGATATAA
Clostridium kluyveri DSM 555
CKL_0828 sufC -41 5.7 TTAAATATGAGTCAAATACTCGGATTTAA
CKL_1317 iscR -71 5.8 TTATTGTTGACAAGTTTACTCTGATTTGA
Clostridium novyi NT
NT01CX_2284 iscR -41 5.6 AGAATTCATAGTATAACACTCGGATTTAA
NT01CX_2284 iscR -82 5.9 TTAATGTTGACAAAAACACTCGGATTTGA
Clostridium perfringens ATCC 13124
CPF_0654 hesB -76 4.8 TTTATTTTGTTTAAAATTATATAATTTAA
CPF_0654 hesB -101 5.3 TAAATTCCTACTAAAATAGTCTTGATTTA
CPF_2350 yxeON -69 5.3 TCAAAGTTGACAATTTTGATGGGAATTAA
CPF_0098 ldh -46 5.5 ATAATTCAGAGTAATTAACTAGGAATTAG
CPF_2040 iscR -80 5.8 TTATTGTTGACAAATTTACTCGGTTTTGA
CPF_2040 iscR -39 5 ATAAAGTACATCGAATTAGTCAGATTTAG
Clostridium tetani E88
CTC01049 iscR -52 5.5 TGAAAGTTTAGTAAAGCAGTAGACTTTCA
CTC01049 iscR -92 5.2 TTATAGTTGACAGGAATACTCGGATTTGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD