Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AraR in Clostridia-1

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Regulog: AraR - Clostridia-1
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clostridium acetobutylicum ATCC 824
CAC1341 araD -430 5.3 ATATTGATACGTATAAATTT
CAC1343 ptk -154 4.6 TGACATATGCGTACAAATAT
CAC1529 arb43 -201 5.7 AAATTTATACGTATAAATTA
CAC1529 arb43 -60 5.3 TAATATGTACGTATATATTA
CAC3436 abf3 -300 4.5 ATATTTATACGTGTTAATTT
CAC1344 araK -103 4.9 AAATAGGTACGTACCATTTT
CAC1344 araK -72 4.5 TGACATGTACGTACAAAAGT
CAC3436 abf3 -228 3.9 CATTTTATGGGTATATAATA
CAC1340 araR -246 4.6 TAATTTGTACTTATAAATGT
CAC1339 araE -215 4.6 CAATTCATACGTATAAAATC
CAC1339 araE -182 4.4 ACATTTATACACATAAATAT
CAC1340 araR -88 5.3 AAATTTATACGTATCAATAT
CAC1340 araR -215 4.7 ATTTTCATACGTATAAATTC
CAC1341 araD -272 4.6 ACATTTATAAGTACAAATTA
CAC1341 araD -303 4.7 GAATTTATACGTATGAAAAT
CAC1343 ptk -186 5.8 AAATTTATACGTACAAATTA
Clostridium beijerincki NCIMB 8052
Cbei_4461 Cbei_4461 -52 4.9 GATGTGGTACGTACATGTTT
Cbei_4464 araJ -267 4.9 TTTCATGTATGTACAAGTAT
Cbei_4451 Cbei_4451 -135 4.4 ATTGATGTACTTACAAGATA
Cbei_4464 araJ -234 4.9 AAAATTGTACATACAATTAT
Cbei_4465 epiA -123 4.9 ATAATTGTATGTACAATTTT
Cbei_4465 epiA -90 4.9 ATACTTGTACATACATGAAA
Cbei_4451 Cbei_4451 -310 4.4 CATGAAGTACGTACAACATA
Cbei_4456 null -99 4.5 CATCAAGTGCGTACAACTTT
Cbei_4457 araA -260 5.1 CATCTTGTATGTACAACATT
Cbei_4457 araA -227 4.6 AAGCTTGTACATACATCAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD