Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FruR2 in Rhodospirillales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose-1-phosphate
Regulog: FruR2 - Rhodospirillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Azospirillum sp. B510
AZL_c02630 fruB -175 5.2 ATCTGAAAACGTTTCCAATC
AZL_c02630 fruB -63 5.2 CACTGTAATCGTTTTCACTT
AZL_c02640 fruR2 -218 5.2 AAGTGAAAACGATTACAGTG
AZL_c02640 fruR2 -106 5.2 GATTGGAAACGTTTTCAGAT
Granulibacter bethesdensis CGDNIH1
GbCGDNIH1_0412 fruB -55 5 CTGTGAAAACGTTTTCATAT
GbCGDNIH1_0413 fruR2 -153 5 ATATGAAAACGTTTTCACAG
Rhodospirillum rubrum ATCC 11170
Rru_A1972 fruB -142 5.4 TTGTGAAATCGTTTTCACTC
Rru_A1973 fruR2 -106 5.4 GAGTGAAAACGATTTCACAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD