Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Phr in Methanosarcinales

Properties
Regulator family: ArsR
Regulation mode: repressor
Biological process: Heat shock response
Effector:
Regulog: Phr - Methanosarcinales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Methanosaeta thermophila PT
Mthe_0612 phr -56 5.5 ATATCTAACTTTTTGTTACTAAC
Mthe_0612 phr -42 5 GTTACTAACCATCAGTTATGATT
Methanosarcina acetivorans C2A
MA4576 phr -315 6.2 ATTGCTAACTAATGGTTACTAAC
Methanosarcina barkeri str. fusaro
Mbar_A0909 phr -189 5.9 GATGCTAACTATAGGTTACTATC
Methanosarcina mazei Goe1
MM1257 phr -299 5.7 ACCGCTAACTAATGGTTACTAAC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD