Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator RbkR in Halobacteriales

Properties
Regulator family: [Other]
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: RbkR - Halobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Haloarcula marismortui ATCC 43049
rrnAC3074 rbkR 215 5.6 GCATTCCACCTTCGGTATGC
rrnAC3074 rbkR 197 4.6 CCGTTCCAAAAGTGGAATGC
Halobacterium salinarum R1
OE3964R rbkR -49 5.2 GCATTCCACTTTCGGTATCC
Halobacterium sp. NRC-1
VNG2126C rbkR -22 5.2 GCATTCCACTTTCGGTATCC
Haloferax volcanii DS2
HVO_0326 rbkR -49 4.9 GCATTCCACTTACGATACGC
Halomicrobium mukohataei DSM 12286
Hmuk_1112 rbkR -49 5 GGATGACACATTCGTTATCC
Haloquadratum walsbyi DSM 16790
HQ3236A rbkR -49 4.9 GCATTCCATGTTCGTTATTC
Halorubrum lacusprofundi ATCC 49239
Hlac_0355 rbkR -67 4.3 GGTTAACGTTTTTGGGATGC
Hlac_0355 rbkR -49 4.9 GCATCTCACATCCGTTACTC
Haloterrigena turkmenica DSM 5511
Htur_2982 rbkR -67 4.5 CCATCACAGTTTTGGTACGC
Htur_2982 rbkR -49 6 GCATGCCACATTCGGTATGC
Natrialba magadii ATCC 43099
Nmag_0941 rbkR -67 4.4 CCATAACAGTTCTGTGATGC
Nmag_0941 rbkR -49 5.8 GCGTACCACATTCGGTACGC
Natronomonas pharaonis DSM 2160
NP0072A rbkR -49 5 CCATACCACATTCGTTACGG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD