Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator RbkR in Thermococcales

Properties
Regulator family: [Other]
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: RbkR - Thermococcales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pyrococcus abyssi GE5
PAB2198 ribU -62 5.5 TCGTTCAAAATTTGGAACAT
Pyrococcus furiosus DSM 3638
PF0163 ribU 133 6.1 TTGTTCTGAAAATGGAACAA
PF0064 ribBA -23 4.6 TAGTTCTATACTTGAGACAT
PF0064 ribBA -56 4.9 CTGTCTTATTTTTGGAACAC
Pyrococcus horikoshii OT3
PH0251 ribU -62 6.2 TTGTTCCAATTATAGAACAT
Thermococcus gammatolerans EJ3
TGAM_1254 ribD 92 6 ATGTTCCAAAAACGGAACAA
Thermococcus kodakaraensis KOD1
TK2194 ribU -62 6.1 TTGTTCTATGTATGGAACAA
TK0424 ribD -52 6 TTGTTCCAACCTTGGAACAA
TK0428 ribBA -62 5.8 TGATTCCATTTTTGGAACAA
TK0428 ribBA -40 4.6 TTTTTAAAAATTTAGAACAT
Thermococcus onnurineus NA1
TON_0610 ribD -53 6.3 TTATTCCAATTTTGGAACAA
TON_1440 ribU -62 5.6 GTGTTTCATATTGGGAACAA
Thermococcus sibiricus MM 739
TSIB_0195 ribU -61 6 ATATTCCAATTATGGAACAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD