Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CblR in Thermoproteales

Properties
Regulator family:
Regulation mode:
Biological process: Cobalamin biosynthesis
Effector:
Regulog: CblR - Thermoproteales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pyrobaculum aerophilum str. IM2
PAE0367 btuF -21 4.5 TAATGGAGGATTCTCCAGCT
PAE0341 null -23 5 TATAGGATTTTTTTCCACTA
PAE0340 cbiE -89 5 TAGTGGAAAAAAATCCTATA
Pyrobaculum islandicum DSM 4184
Pisl_0226 nrdD -23 6 TATGGGAAATTTGTCCCTTA
Pyrobaculum calidifontis JCM 11548
Pcal_1528 cbiE -65 5.1 GTTGGGATATTTCTCCTATA
Pcal_1527 cbtA -239 5.1 TATAGGAGAAATATCCCAAC
Pcal_1519 btuF -21 5.9 TATGGGATATTTCTCCCACA
Thermoproteus neutrophilus V24Sta
Tneu_0378 nrdD -23 5.8 TATGGGAAATTTGTCCCCTA
Tneu_0292 cbtA -232 5.1 TTAGGGATTTTTCTCCATCA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD