Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HutC in Ralstonia

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Regulog: HutC - Ralstonia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Cupriavidus taiwanensis
RALTA_A2496 hisX -247 5.7 GATCCTGTCTATACAGCAAC
RALTA_A2496 hisX -93 5.4 TGACTTGTATATACAGGCAT
RALTA_A2492 hutH -26 5.6 TAAGCTGTATAGACAGGAAC
RALTA_A0654 hutU -83 5.6 GCACTTGTATATACAGGAAT
Ralstonia eutropha H16
H16_A3018 hutH -26 5.6 TAAGCTGTATAGACAGGAAC
H16_A3022 hisX -93 5.6 TGACTTGTATATACAGGTAC
H16_A3022 hisX -249 5.2 TGTCCTGTCTATACAGCAGC
H16_A0695 hutU -83 5.4 ATGCCTGTATATACAGGACT
Ralstonia eutropha JMP134
Reut_A0896 hutU -94 5.6 ATGCTTGTATATACAACACT
Reut_A2720 hisX -94 5.7 TGACTTGTATATACAGGATT
Reut_A2716 hutH -40 5.6 TAAGCTGTATAGACAGGAAC
Reut_A2720 hisX -249 5.4 ACTCCTGTCTATACAGCAAC
Reut_B5636 hutU -94 5.6 ATGCTTGTATATACAACACT
Ralstonia metallidurans CH34
Rmet_2859 hisX -114 5.2 TGACTTGTATATACAGCGTT
Rmet_5048 hutU -88 4.7 CAACTTGTCTATACAATACT
Rmet_2855 hutH -59 5.1 TAACCTGTATAGACAGGCCC
Rmet_2859 hisX -271 5.8 CTTGTTGTATATACAGCAAT
Ralstonia pickettii 12J
Rpic_2882 hutC -114 6.1 TATGTTGTATATACAACTTA
Rpic_2881 hutU -60 6.1 TAAGTTGTATATACAACATA
Rpic_0834 hisT -126 5.5 CATGATGTATATACAACAAC
Ralstonia solanacearum GMI1000
RSc2647 hutU -53 5.8 TTATTTGTATATACAACATA
RSc2648 hutC -99 5.8 TATGTTGTATATACAAATAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD