Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HutC in Alteromonadales

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Regulog: HutC - Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pseudoalteromonas atlantica T6c
Patl_1019 hutI -50 5.7 ATACAAGTATGTACAAGTAA
Patl_1020 hutC -66 5.7 TTACTTGTACATACTTGTAT
Patl_1019 hutI -60 6.5 AAACTTGTATATACAAGTAT
Patl_1020 hutC -56 6.5 ATACTTGTATATACAAGTTT
Pseudoalteromonas haloplanktis TAC125
PSHAa2737 hutI -70 5.3 TACCTTGTATATACAAGATG
PSHAa2738 hutC -70 5.3 CATCTTGTATATACAAGGTA
Pseudoalteromonas tunicata D2
PTD2_07449 hutC -69 5.1 CGGCTTGTATATACAATACT
PTD2_07454 hutI -68 5.1 AGTATTGTATATACAAGCCG
Idiomarina loihiensis L2TR
IL1834 hisG -301 4.4 TTATTTGACTATACAACCAC
IL2453 hutI -62 6.1 ATAATTGTATATACAAGCAG
IL2452 hutC -81 6.1 CTGCTTGTATATACAATTAT
Idiomarina baltica OS145
OS145_09068 hutI -77 4.3 TCATTTGTCTATACAACCTG
OS145_09063 hutC -70 4.3 CAGGTTGTATAGACAAATGA
Alteromonas macleodii 'Deep ecotype'
MADE_03128 hutC -89 4.9 GTACTTGTGCATACTTGTAT
MADE_03128 hutC -79 6.7 ATACTTGTATATACAAGTAT
MADE_03129 hutI -101 6.7 ATACTTGTATATACAAGTAT
MADE_03129 hutI -91 4.9 ATACAAGTATGCACAAGTAC
Alteromonadales bacterium TW-7
ATW7_17853 hutI -69 4.8 CCTCTTGTATATACAAGATG
ATW7_17848 hutC -71 4.8 CATCTTGTATATACAAGAGG
ATW7_17843 hutU -28 4.3 CACCTTGTATATACAACAGG
Colwellia psychrerythraea 34H
CPS_4353 hutG -46 5.1 CAAGTTGTATATACAATTTG
CPS_4933 hutX -192 3.8 GAGCGGGTATATACATAAAT
CPS_3889 hisG -54 5 TAAATTGTATATACATGACG
CPS_0911 hutI -153 5.5 AGAGTTGTATATACAAGTTG
CPS_0910 hutC -80 5.5 CAACTTGTATATACAACTCT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD