Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator PhrR in Psychromonadaceae/Aeromonadales

Properties
Regulator family: MerR
Regulation mode: repressor
Biological process: Light-dependent DNA repair
Effector: Adenosylcobalamin; Blue light
Regulog: PhrR - Psychromonadaceae/Aeromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Aeromonas hydrophila subsp. hydrophila ATCC 7966
AHA_1099 COG3272 -65 6.5 TATACAACTTACAATTTTTTGTATA
AHA_1099 COG3272 -18 6.1 TATACAAGGAGTGATGATATGTACA
Aeromonas salmonicida subsp. salmonicida A449
ASA_3232 COG3272 -18 6 TATACAAGGAGTGCCAACATGTACA
ASA_3232 COG3272 -75 5.9 TATACAGCTTCCATTATTTTGTATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD