Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator PhrR in Vibrionales

Properties
Regulator family: MerR
Regulation mode: repressor
Biological process: Light-dependent DNA repair
Effector: Heat shock; Adenosylcobalamin
Regulog: PhrR - Vibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Vibrio angustum S14
VAS14_11844 COG3272 -87 6.2 TATACAATAAAAAAACTTGTACA
Vibrio cholerae O1 biovar eltor str. N16961
VCA0055 COG3272 -76 6.7 TGTACAAAAAAAATATTTGTACA
VCA0055 COG3272 -28 5.8 TGTACAGAAATTTTCATTGTATA
VC1118 PF07366 -32 5.6 TATACGAATCTTAAATTTGTATA
Vibrio harveyi ATCC BAA-1116
VIBHAR_05120 COG3272 -81 6 TGTACATTTTATTTTCTTGTACA
VIBHAR_05120 COG3272 -35 6.1 TATACAACAAAACATTTTGTATA
VIBHAR_01814 PF07366 -51 6.5 TGTACATATAATATTTTTGTACA
Vibrio parahaemolyticus RIMD 2210633
VPA1473 COG3272 -83 6.4 TGTACAACTAATTTTCTTGTACA
VP1119 PF07366 -51 6.3 TGTACATGTAATATTTTTGTACA
VP1119 PF07366 -96 6.4 TATACAAGTTTTTTTTTTGTACA
VPA1473 COG3272 -37 6.2 TATACAACTAAACTTTTTGTATA
Vibrio shilonii AK1
VSAK1_17997 COG3272 -78 5.6 TGTACAAGATAGAATTTTGTATC
VSAK1_00115 PF07366 -95 4.6 TATACAAAAAGTTGTACTTTCCA
Vibrio vulnificus CMCP6
VV1_2936 PF07366 -93 5.5 TATACAAAAAAACAATCGGTATA
VV21541 COG3272 -35 6.7 TGTACAAGTAATTTTTTTGTACA
VV21541 COG3272 -81 6.7 TGTACAAAAAAAATATTTGTACA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD