Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator PhrR in Pseudomonadaceae

Properties
Regulator family: MerR
Regulation mode: repressor
Biological process: Light-dependent DNA repair
Effector: Blue light; Adenosylcobalamin
Regulog: PhrR - Pseudomonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Azotobacter vinelandii AvOP
Avin_10270 folM -78 4.4 TGTACAAAGCGGGACACTGCTATA
Avin_41400 COG3272 -43 5 TATACAAATCATGAAAGCTGTACA
Avin_41400 COG3272 -94 5.7 TGTACAAACTGTTGATCATGTACA
Pseudomonas aeruginosa PAO1
PA4657 COG3380 -73 5.9 TGTACATTAAATCAAGCTTGTACA
PA4658 COG3272 -106 5.9 TATACAAATACATTGACCTGTACA
Pseudomonas entomophila L48
PSEEN0885 COG1090 -137 5.5 TGTACAATGCACAATGTTTGTATA
PSEEN0884 COG3380 -74 5.9 TATACAAACATTGTGCATTGTACA
PSEEN2737 PSEEN2737 -49 6.3 TGTACAAGAACCTAGTCTTGTACA
PSEEN0883 COG3272 -43 5 TGTACAAACCAAGCCTTCTGTACA
PSEEN0883 COG3272 -93 5.6 TATACAGAAAGTAACACTTGTATA
PSEEN2706 PF07366 -94 6.1 TGTACAAGACTATTGACCTGTACA
PSEEN2706 PF07366 -43 4.6 TGTACAAAATCACCTCGCTGTACA
Pseudomonas fluorescens Pf-5
PFL_5142 COG1090 -147 5.6 TGTACAATATTGTTTTTTGGTATA
PFL_5143 COG3380 -71 5.7 TATACCAAAAAACAATATTGTACA
PFL_2258 folE -229 4.3 TGTACAGATAAAAAGTATTGAATC
PFL_2258 folE -190 4.8 TGTACAAGTATTTGGGCTTATAAG
PFL_2258 folE -145 4.4 TGTACAAAAAATTAAATTGTCGTA
PFL_2328 mcp3 -134 6.1 TGTACATGAAACTTTTTTTGTACA
PFL_5145 COG3272 -97 6.5 TATACAAATAATTTGACTTGTACA
Pseudomonas mendocina ymp
Pmen_1073 COG3272 -42 5.2 TGTACATGCACCAACATATGTACA
Pmen_1076 COG1090 -131 6.1 TATACAAGAATGTTTTCATGTACA
Pmen_1075 COG3380 -75 5.9 TGTACATGAAAACATTCTTGTATA
Pmen_3288 folM -251 5.6 TGTACAAAACACATGGATCGTACA
Pmen_3288 folM -118 4.6 TGTACAACCCGCAGCTCTGGTATA
Pmen_1353 mcp1 -94 5.6 TATACAAACAGGAATTCATGTACA
Pmen_1073 COG3272 -92 6.4 TGTACAAATCATTTGACTTGTACA
Pseudomonas putida KT2440
PP0743 COG1090 -136 5.3 TGTACAATGCCAAAATTATGTATA
PP0742 COG3380 -74 5.8 TATACATAATTTTGGCATTGTACA
PP2511 null -35 4.7 TATACAAAAACTTGTACAAGCATG
PP2511 null -23 5.1 TGTACAAGCATGAGAGGTTGTACA
PP0741 COG3272 -95 5.6 TATACAAAAATACTAGTTTGCATA
PP2738 PF07366 -94 6.1 TATACAAGACCGTTGACTTGTATA
PP2738 PF07366 -43 5.7 TGTACAACAATTCAATTTTGTACA
PP0741 COG3272 -45 5 TGTACAAGTTTCGAGTCACGTACA
Pseudomonas stutzeri A1501
PST_1967 COG1090 -85 5.2 TGTACATTCGAATAACCATGTATA
PST_0951 PF04134 -57 5.2 TGTACAGGATTATTGTTTTGTTCA
PST_1966 COG3272 -217 5.3 TATACATGGTTATTCGAATGTACA
Pseudomonas syringae pv. tomato str. DC3000
PSPTO1127 COG1090 -240 5.5 TGTACAATCTTCTTGTTTGGTATA
PSPTO1126 COG3380 -71 5.4 TATACCAAACAAGAAGATTGTACA
PSPTO3689 phrB -47 6 TGTACAAAAATTTACATTGGTACA
PSPTO1183 folM -101 6.1 TGTACAAAAAAATTCTCTGGTATA
PSPTO1123 COG3272 -101 6.1 TCTACAAAGAATTTGACTTGTACA
PSPTO1123 COG3272 -51 4.9 TGTACAGCACAGTTAATCTGTACA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD