Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BglR in Bifidobacteriaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Regulog: BglR - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium adolescentis ATCC 15703
BAD_1290 bglE -68 5.9 AAATCTAAGCGCTTAAATTG
BAD_1290 bglE -42 6.7 CAATCTAAGCGGTTAGATTG
BAD_1291 bglR -25 5.8 GCATCAAAGCGCTTAGACTG
Bifidobacterium angulatum DSM 20098
BIFANG_00261 bglE -71 5.1 CAATCTATGCGCTTAAATAT
BIFANG_00261 bglE -45 6.6 CAGTCTAACCGCTTAGATTG
BIFANG_00262 bglR -25 5.8 GTATCAAAGCGGTTAGACTG
Bifidobacterium breve DSM 20213
BIFBRE_00248 bglE -52 6.4 CAATCTACGCGGTTAGATTG
Bifidobacterium dentium Bd1
BDP_0952 bglE -72 5.6 CAATCTAAGCGCTTAAATAT
BDP_0952 bglE -46 6.6 CAGTCTAACCGCTTAGATTG
BDP_0953 bglR -220 5.3 GTACCAAAGCGCTTAAATTG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD