Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator MntR in Staphylococcaceae

Properties
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Staphylococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Staphylococcus aureus subsp. aureus N315
SA0589 mntA -42 6.1 TAATTAGGTTAGCCTAAACT
SA0956 mntH -67 6.3 AATTTAGGTTGACCTAAACA
Staphylococcus capitis SK14
STACA0001_0395 mntA -42 6.1 AAATTAGGTTAGCCTAAACT
STACA0001_2258 mntH -66 6.1 TTTTTAGGTTGACCTAACTT
Staphylococcus epidermidis ATCC 12228
SE0407 mntA -42 6.4 AAATTAGGTTAACCTAAACT
SE0803 mntH -51 6.3 TTTTTAGGTTGACCTAATAT
SE0803 mntH -29 4.6 TATTTAGGTTAATATATTCT
Staphylococcus carnosus subsp. carnosus TM300
Sca_0731 mntH -76 6.1 TTTTTAGGTTGACCTAACTT
Sca_0275 mntA -141 6.2 AAATTAGGTTAGCCTAAAAA
Staphylococcus haemolyticus JCSC1435
SH1847 mntH -65 6.3 TTATTAGGTTGACCTAAAAA
SH0143 mntA -40 6.4 AAATTAGGTTAACCTAAACT
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
SSP1685 mntH -73 6.3 TTTTTAGGTTGACCTAATAA
SSP2086 mntA -40 6.2 AAATTAGGTTAGCCTAAAAA
Macrococcus caseolyticus JCSC5402
MCCL_0368 mntH -52 5.7 TTTTTAGGTTGCCCTAAAGA
MCCL_0095 mntA -52 5.9 AGTTTAGGTTTGCCTAAAAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD