Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Bifidobacteriaceae

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium adolescentis ATCC 15703
BAD_0828 hrcA -115 7.1 TTAGCACTCCGGGCGCCGGAGTGCTAA
BAD_0565 groL -137 7 TTGGCACTCTCGACGTGAGAGTGCTAA
BAD_0292 groS -146 7.4 TTAGCACTCGAGTTGGCAGAGTGCTAA
BAD_0565 groL -102 7.1 TTAGCACTCGACGAGTGAGAGTGATAA
Bifidobacterium angulatum DSM 20098
BIFANG_00586 groL -95 7.2 TTGGCACTCTCGCACCTTGAGTGCTAA
BIFANG_00586 groL -60 7.1 TTAGCACTCAAGGTGCGAGAGTGATAA
BIFANG_00124 groS -142 7.4 TTAGCACTCGAGTTGGCAGAGTGCTAA
Bifidobacterium animalis subsp. lactis AD011
BLA_1356 hrcA -62 6.9 TTAGCACTCCTGTATGCAGAGTGCTAA
BLA_1183 groL -116 7.1 TTGGCACTCGACCACTGAGAGTGCTAA
BLA_0343 groS -137 7.4 TTAGCACTCGAGTTGGCAGAGTGCTAA
Bifidobacterium bifidum NCIMB 41171
BbifN4_010100004769 hrcA -152 6.9 TTAGCACTCAAGGGCAAAGAGTGCTAA
BbifN4_010100002804 groL -142 7.3 TTGGCACTCGGGCACCGAGAGTGCTAA
BbifN4_010100002804 groL -107 6.5 TTAGCACTCGGGGAGTGAGAGTGACAG
BbifN4_010100007652 groS -150 6.9 TTAGCAGTCGAGTTGGCAGAGTGCTAA
Bifidobacterium breve DSM 20213
BIFBRE_01333 hrcA -95 6.7 TTAGCACTCGAAACCAATGAGTGCTAA
BIFBRE_00229 groS -138 7.4 TTAGCACTCGAGTTGGCAGAGTGCTAA
BIFBRE_00532 groL -111 7 TTAGCACTCGGAGATCGAGAGTGATAA
BIFBRE_00532 groL -146 7 TTGGCACTCGGCAAGGGCGAGTGCTAA
Bifidobacterium dentium Bd1
BDP_1146 hrcA -138 6.9 TTAGCACTCCTCGGCCGGGAGTGCTAA
BDP_0772 groL -140 7.2 TTGGCACTCGAGGCCCGAGAGTGCTAA
BDP_0772 groL -104 7.2 TTAGCACTCGAGGAGTGAGAGTGATAA
BDP_0405 groS -147 7.4 TTAGCACTCGAGTTGGCAGAGTGCTAA
Bifidobacterium gallicum DSM 20093
BIFGAL_01682 hrcA -274 7.4 TTAGCACTCTGGCGCCAAGAGTGCTAA
BIFGAL_01875 groL -134 7 TTGGCACTCGACCAAGGAGAGTGCTAA
BIFGAL_01875 groL -98 7.1 TTAGCACTCGAGGCGTGAGAGTGATAA
BIFGAL_00768 groS -167 7.2 TTAGCACTCGAATTGGCAGAGTGCTAA
Bifidobacterium longum NCC2705
BL0718 hrcA -191 6.6 TTAGCACTCAAGCCTAAGGAGTGCTAA
BL0002 groL -62 5.2 TCACGACTCGACGCTTGCGAGTGATAA
BL0002 groL -110 7 TTAGCACTCGGAGGTCGAGAGTGATAA
BL0002 groL -145 7.1 TTGGCACTCGGCGGGCGCGAGTGCTAA
BL1558 groS -140 7.4 TTAGCACTCGAGTTGGCAGAGTGCTAA
Bifidobacterium longum subsp. infantis ATCC 15697
Blon_0694 groL -145 7 TTGGCACTCGGCGGTCGCGAGTGCTAA
Blon_1097 hrcA -191 6.6 TTAGCACTCAAGCCTAAGGAGTGCTAA
Blon_0694 groL -62 5.2 TCACGACTCGACGCTTGCGAGTGATAA
Blon_0694 groL -110 7 TTAGCACTCGGAGGTCGAGAGTGATAA
Blon_2257 groS -140 7.4 TTAGCACTCGAGTTGGCAGAGTGCTAA
Gardnerella vaginalis 409-05
HMPREF0424_0717 groL -95 6.8 TTAGCACTCAAGCCTTGAGAGTGATAA
HMPREF0424_0717 groL -130 7 TTGGCACTCGGGTACATAGAGTGCTAA
HMPREF0424_0234 groS -140 7.4 TTAGCACTCGAGTTGTTAGAGTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD