Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BgrT8 in Bifidobacteriaceae

Properties
Regulator family: TetR
Regulation mode:
Biological process: Beta-glucosides utilization
Effector:
Regulog: BgrT8 - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium animalis subsp. lactis AD011
BLA_0894 bgrT8 -154 4.4 AGGTGACGCGTTGCTCACTC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD