Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BgrT7 in Bifidobacteriaceae

Properties
Regulator family: TetR
Regulation mode:
Biological process: Galactosides utilization
Effector:
Regulog: BgrT7 - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium dentium Bd1
BDP_1670 bgaT2 -84 5.2 AAGTTATCTGGTAGTAACCA
BDP_1668 BDP_1668 -148 5.2 AAGTTATCAACCAGTAAGTT
BDP_1668 BDP_1668 -126 5.5 TAGTTAGTAATCAATAACAA
BDP_1669 bgrT7 -167 5.2 TGGTTACTACCAGATAACTT
BDP_1669 bgrT7 -145 5.6 AAGTTAGCTACCGATAACTT
BDP_1668 BDP_1668 -133 4.8 AAGTTACTAGTTAGTAATCA
BDP_1669 bgrT7 -52 5.2 TAATTATTAATTGGTAACTT
BDP_1670 bgaT2 -199 5.2 AAGTTACCAATTAATAATTA
BDP_1670 bgaT2 -106 5.6 AAGTTATCGGTAGCTAACTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD