Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BgrT6 in Bifidobacteriaceae

Properties
Regulator family: TetR
Regulation mode:
Biological process: Galactosides utilization
Effector:
Regulog: BgrT6 - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium adolescentis ATCC 15703
BAD_1206 bgaT -158 7 TATCTTATATCTTTAAGATA
BAD_1206 bgaT -151 6.8 TATCTTTAAGATATAAGATA
BAD_1207 bgrT6 -101 6.8 TATCTTATATCTTAAAGATA
BAD_1207 bgrT6 -94 7 TATCTTAAAGATATAAGATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD