Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BgrT5 in Bifidobacteriaceae

Properties
Regulator family: TetR
Regulation mode:
Biological process: Cellobiose utilization
Effector:
Regulog: BgrT5 - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium adolescentis ATCC 15703
BAD_0439 cbpA -107 7.1 TTATTTATAAGTTTATAAACAA
Bifidobacterium dentium Bd1
BDP_2127 cbpA -146 7.7 TTATTTATAAAGTTATAAATAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD