Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ThiR in Sulfolobales

Properties
Regulator family: [Other]
Regulation mode: repressor
Biological process: Thiamine transport; Thiamine biosynthesis
Effector: Thiamine phosphate
Regulog: ThiR - Sulfolobales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Metallosphaera sedula DSM 5348
Msed_2221 thi4 -42 6.1 TTTATAACTTAGTTTATAAG
Msed_0906 thiC -18 5.8 CTTATAACTTACTTTATAAT
Sulfolobus acidocaldarius DSM 639
Saci_0854 thi4 -38 5.7 CATATAAGTGAGTTTATAAC
Saci_0137 thiC -30 5.2 TTTATAATCTAGTTTATTGA
Saci_2110 thiT -42 5.3 AATATAACTAACTTTATAAC
Sulfolobus islandicus Y.N.15.51
YN1551_2514 thiT -42 5.3 AAAATAAGTGACTTTATAAG
YN1551_1140 thi4 -41 5.7 TATAAAAGTTAATTTATAAG
YN1551_2613 tenA -41 5.5 CTTATAAAATGATTTATAAT
Sulfolobus solfataricus P2
SSO1593 thiT -42 5.3 AAAATAAGTGACTTTATAAG
SSO0436 thi4 -41 5.7 TATAAAAGTTAATTTATAAG
SSO2089 tenA -41 5.6 GTTATAAAATAATTTATAAT
Sulfolobus tokodaii str. 7
ST0361 thi4 -31 5.4 TATATTAGCTAGTTTATAAT
ST1132 thiT -42 5.6 CATATAAGTAGGTTTATAAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD