Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator MalR in Staphylococcaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Regulog: MalR - Staphylococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Staphylococcus aureus subsp. aureus N315
SA0206 mdxK -66 6.7 TTGTGCAAACGTTTTCACAA
SA1339 malR -112 6.9 TTATGCAATCGTTTGCACAA
Staphylococcus haemolyticus JCSC1435
SH1407 malR -228 6.6 TTATGCAAACGATTGCATTA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
SSP1245 malR -106 6.4 TCGCGCAAACGTTTGCACAA
Macrococcus caseolyticus JCSC5402
MCCL_0353 mdxE -110 6.7 TTATGCAATCGTTTGCAAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD