Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Blon_0374 in Bifidobacteriaceae

Properties
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Regulog: Blon_0374 - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium longum subsp. infantis ATCC 15697
Blon_0375 Blon_0375 -36 4.9 ATATTGAAGCGTATAACTAA
Blon_0375 Blon_0375 -106 6.2 TAGTTTATGCGCATCAACAC
Blon_0375 Blon_0375 -52 6.3 TCATTTATGCGCATCAATAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD