Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BgaR in Bifidobacteriaceae

Properties
Regulator family: LacI
Regulation mode:
Biological process: Galactosides utilization
Effector: Beta-galactosides
Regulog: BgaR - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium angulatum DSM 20098
BIFANG_00301 bgaR -176 6 AAATGTTTGCGTTATCATTA
BIFANG_00302 bgaB -124 4.8 AAATGGTTTCGTCACCATTT
BIFANG_00302 bgaB -35 6 TAATGATAACGCAAACATTT
Bifidobacterium animalis subsp. lactis AD011
BLA_0464 bgaY -191 5.2 AACTGTTTGCGCAATCATGC
BLA_0464 bgaY -114 5.9 CTATGTTTGCGTAAACATTC
BLA_0461 bgaX -83 6.4 ATATGTTTGCGCAAACATAA
BLA_0465 bgaR -174 5.9 GAATGTTTACGCAAACATAG
BLA_0465 bgaR -97 5.2 GCATGATTGCGCAAACAGTT
Bifidobacterium bifidum NCIMB 41171
BbifN4_010100008751 bgaR -128 5.7 AAATGTTTGCGTTACCATGA
BbifN4_010100008756 bgaZ -200 4.7 CTATGTTTTGGTTACCATCA
BbifN4_010100008756 bgaZ -118 5.7 TCATGGTAACGCAAACATTT
Bifidobacterium breve DSM 20213
BIFBRE_00764 bgaX -156 5.3 AGATGTTATCGCAACCATAG
BIFBRE_00761 bgaR -208 5.5 AATTGTTTACGTTATCATCA
Bifidobacterium dentium Bd1
BDP_0658 abfA1 -169 6 ATATGTTTACGCAAACAAAA
BDP_0655 bgaY -270 5.1 TAATGTTTTCGTCATCATAG
BDP_0655 bgaY -179 5.5 TTCTGATAACGTAAACATTT
BDP_0659 bgaX -124 6 TTTTGTTTGCGTAAACATAT
Bifidobacterium longum NCC2705
BL1166 abfA1 -71 5.8 TTATGTTTACGCAAACACGA
BL1170 bgaY -44 5.8 TGATGATAACGCAAACATTT
BL1165 bgaX -108 5.8 TCGTGTTTGCGTAAACATAA
BL1164 bgaX -170 5.3 AGATGTTATCGCAACCATAG
BL1171 bgaR -192 5.8 AAATGTTTGCGTTATCATCA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD