Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AouR in Bifidobacteriaceae

Properties
Regulator family: LacI
Regulation mode:
Biological process: Arabinose oligosaccharide utilization
Effector:
Regulog: AouR - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium animalis subsp. lactis AD011
BLA_1513 hypBA1 -113 5.3 GGAAGGAAATATTTCCCAAC
BLA_1514 aouR -47 5.3 GTTGGGAAATATTTCCTTCC
Bifidobacterium dentium Bd1
BDP_1706 aouA -152 4.2 TGATGAAATGATTTTGAAAA
BDP_1706 aouA -274 4.6 ATATGAAACAGTTTTCGCAT
BDP_1707 aouR -296 4.2 TTTTCAAAATCATTTCATCA
BDP_1701 hypBA2 -257 4.5 AGGAGAAATATTTTTCATAT
BDP_1707 aouR -174 4.6 ATGCGAAAACTGTTTCATAT
BDP_1701 hypBA2 -196 4.2 TTGTGAAAAAATTTCGCATC
Bifidobacterium longum NCC2705
BL0425 aouA -381 4.4 ATGCGAAAACTTTCGCAAAC
BL0425 aouA -153 3.8 TTTTGCAAAAACTTCCATGT
BL0426 aouR -124 4.4 GTTTGCGAAAGTTTTCGCAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD