Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator LexA in Staphylococcaceae

Properties
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Regulog: LexA - Staphylococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Staphylococcus aureus subsp. aureus N315
SA0684 SA0684 -124 4.8 CACAGAACGTTTGTTCGGTA
SA1749 SA1749 -133 5.7 AACAGAACATATGTTCGTAT
SA1975 SA1975 -66 4.9 ACCCGAAAATATGTTCGTGT
SA1180 sbcD -31 5.3 AAGCGAACAAATGTTCTATA
SA0713 uvrB -107 5.4 TTACGAACAAACGTTTGCTT
SA1196 uvrX -79 5 AACAGAACATTTGTTCTAAA
SA1196 uvrX -51 4.8 AATAGAACACGTGTTCGTAT
SA1738 null -51 5.3 AACAGAACACATGTTCGTAT
SA1128 recA -102 5.4 ATACGAACAAATATTCGCAA
SA1128 recA -145 5.1 ATAAGCACGTTTGTTCGTTT
SA1174 lexA -74 5.6 TAACGAACAAATGTTTGTTT
SA1188 parE -32 5.3 AAACGAACGTACGTTTGCAG
SA1174 lexA -132 4.9 CCTAGAACATTTGTTTGTAT
Staphylococcus capitis SK14
STACA0001_0273 uvrB -126 5.4 AAGCGAACAAACGTTTGCTT
STACA0001_1610 null -78 5 AATAGAACATTCGTTCTTGT
STACA0001_1610 null -49 4.9 ATAAGAACACGTGTTCTTAT
STACA0001_1975 null -52 5.6 AATAGAACAAATGTTCGTAT
STACA0001_1593 sbcD -33 5.9 ATACGAACAAATGTTCTTAT
STACA0001_1306 SA1975 -65 5.2 ACACGAAAGTATGTTCGCTT
STACA0001_1989 SA1749 -125 5.3 TATAGAACATATGTTCGCTA
STACA0001_0299 SA0684 -123 4.8 AACAGAACATGTGTTCGTGA
STACA0001_2334 recA -103 5.1 ACACGAACAAATATTCGCAA
STACA0001_1582 lexA -132 4.7 CCTAGAACGTTTGTTTGTAT
STACA0001_1582 lexA -103 4.8 ATCAGAACGAATGTTCTGTG
STACA0001_1582 lexA -74 5.7 AAACGAACAAACGTTTGTTT
STACA0001_1601 parE -33 5.4 AAACGAACGTACGTTTGTAG
STACA0001_2334 recA -146 4.9 ATAAGTACGTTTGTTCGATT
Staphylococcus epidermidis ATCC 12228
SE1046 uvrX -77 5.7 ATAAGAACAAATGTTCTTAT
SE1046 uvrX -48 4.7 AATAGAACACGTGTTCTTAT
SE1605 null -52 5.6 AACAGAACAAATGTTCGTAT
SE0541 uvrB -130 5.7 AAGCGAACAAATGTTTGTAT
SE1028 sbcD -33 5.7 AAACGAACAAACGTTCTTAT
SE1762 SA1975 -66 5.1 GTACGAAAGTATGTTCGCAT
SE0963 recA -102 5.4 ATACGAACAAATATTCGCAA
SE0511 SA0684 -116 5.9 AAGCGAACATTTGTTCGTTT
SE1627 SA1749 -127 5.1 AACAGAACGTATGTTCTGTT
SE0963 recA -145 5.1 ATAAGTACGTTTGTTCGTTT
SE1036 parE -33 5.2 TAACGAACGTACGTTTGTAG
SE1022 lexA -517 4.9 cctaGAACATtTGTTtGTAT
SE1022 lexA -459 5.5 tTACGAACAaATGTTtGTta
Staphylococcus carnosus subsp. carnosus TM300
Sca_0980 lexA -132 4.7 CCCAGAACATTTGTTTGCAT
Sca_0980 lexA -103 4.9 ATCAGAACGATTGTTCGCTG
Sca_0980 lexA -74 5.5 TTACGAACAAATGTTTGTAA
Sca_0995 parE -35 5.4 TAACGAACGTATGTTTGTAG
Sca_0926 recA -102 5 AATCGAACAAACATTCGCAA
Sca_0377 SA0684 -126 5.5 AACAGAACATATGTTCGATT
Sca_1672 SA1975 -68 5.1 GACCGAAAATATGTTCGTTT
Sca_0407 uvrB -267 4.8 CTGCGAACAGATGTTTGTAC
Sca_1008 uvrX -82 5.2 AACAGAACATTTGTTCTTTA
Sca_1008 uvrX -53 5.7 ATAAGAACAAATGTTCGCAT
Sca_1497 null -59 5.3 TAGCGAACAAGTGTTCGTAT
Staphylococcus haemolyticus JCSC1435
SH1018 SA1749 -129 5.9 AAACGAACAAATGTTCGCTT
SH2164 SA0684 -124 5.6 AACAGAACATTTGTTCGTAT
SH1628 recA -105 5.2 AAGCGAACAAATATTCGCAA
SH1568 lexA -132 5 TCTAGAACATTTGTTTGTAT
SH1568 lexA -103 4.8 AACAGAACATCTGTTCTTAG
SH1568 lexA -74 5.4 AAACGAACAAATGTTTGTTC
SH1554 parE -32 5.4 AAACGAACGTACGTTTGTAG
SH0869 SA1975 -66 5.2 CACCGAAAATATGTTCGTAT
SH1562 sbcD -31 5.2 ACACGAACAAATGTTCTAAA
SH2131 uvrB -266 5.5 AAGCGAACAAACGTTTGTAT
SH1545 uvrX -81 4.9 TAAAGAACATTAGTTCTTAT
SH1545 uvrX -52 5.8 AAAAGAACAAATGTTCGTAT
SH0364 null -39 5.4 ATgCGAACATATGTTCtata
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
SSP0868 null -51 5.6 AATAGAACGTATGTTCGTAT
SSP1388 uvrX -51 5.6 AATAGAACATTTGTTCGTAT
SSP1388 uvrX -80 5.1 ATTGGAACATTTGTTCTTAT
SSP1959 uvrB -176 5.6 CTACGAACAAATGTTTGTTT
SSP1412 sbcD -33 5.2 ATACGAACAAACGTTCTAAG
SSP0715 SA1975 -66 5.3 TTACGAAAGTATGTTCGCAT
SSP0853 SA1749 -135 5.1 AACAGAACGTGTGTTCGTAT
SSP1988 SA0684 -125 5.1 TACAGAACATTTGTTCGTGT
SSP1480 recA -104 5.1 TAGCGAACAAATATTCGCAA
SSP1418 null -131 4.7 CCTAGAACGTTTGTTTGTAT
SSP1418 null -102 4.9 ATCAGAACATTTGTTCTATG
SSP1418 null -73 5.5 AAACGAACAAACGTTTGTAA
SSP1404 parE -33 5.4 AAACGAACGTACGTTTGTAG
Macrococcus caseolyticus JCSC5402
MCCL_1665 null -34 5.4 AACAGAACGTACGTTCGTAT
MCCL_1033 uvrX -10 4.9 AATAGAACGTATGTTCTGGT
MCCL_0875 recA -132 5.2 ATACAAACAGACGTTCGCAT
MCCL_0509 uvrB -67 5.3 TTACGAACAAATGTTTGTAC
MCCL_1033 uvrX -38 5.4 ATAAGAACATACGTTCTATT
MCCL_1011 parE -31 5.2 TTTCGAACGTATGTTTGTAG
MCCL_0995 lexA -77 5.7 ATACGAACAAATGTTTGTTA
MCCL_0995 lexA -135 4.9 CCTAGAACATTTGTTTGTAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD