Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BDP_2071 in Bifidobacteriaceae

Properties
Regulator family: ROK
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Regulog: BDP_2071 - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium dentium Bd1
BDP_2070 BDP_2070 -106 6 TTGAGTTTGACAACTGAACGCAA
BDP_2071 null -173 6 TTGCGTTCAGTTGTCAAACTCAA
Bifidobacterium longum NCC2705
BL1694 BDP_2070 -113 5.9 TTGAGTTTGACAACTTAACTCAA
BL1693 null -161 5.9 TTGAGTTAAGTTGTCAAACTCAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD