Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NanR in Bifidobacteriaceae

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Sialic acid utilization
Effector: Sialic acid
Regulog: NanR - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium longum subsp. infantis ATCC 15697
Blon_0647 nanB -250 4.9 GGGAAACATCAGACGTCTGAT
Blon_0646 nanH -200 6.5 ATAAGACGTCTGACGTCTTAT
Blon_0643 SSF51658 -73 5.2 GATATACATCAGATGTCTGAT
Blon_0646 nanH -102 5 ATCAGACGTCTGATGTTTCCC
Blon_0643 SSF51658 -66 5.4 ATCAGATGTCTGATGTATAAT
Blon_0647 nanB -152 6.6 ATAAGACGTCAGACGTCTTAT
Bifidobacterium breve DSM 20213
BIFBRE_01949 SSF51658 -36 6.3 ATTGGACATCAGACGTCTGAT
BIFBRE_01954 nanB -149 5.5 ATAAGTTGTCTGATGTCTTAA
BIFBRE_01954 nanB -42 5.8 ATCAGACATCAGATGTCATAT
Bifidobacterium gallicum DSM 20093
BIFGAL_00397 SSF51658 -220 6.1 GTAAGACATCAGATGTCTGAT
BIFGAL_00396 nanB -12 6.2 ATCAGACATCTGATGTCTTAC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD