Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GarR in Bacillales

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: Galactarate utilization
Effector: Galactarate
Regulog: GarR - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus clausii KSM-K16
ABC3016 garR -42 6.3 TGTGATATATCAGATTTCATA
Oceanobacillus iheyensis HTE831
OB2848 null -48 6.6 TCTGATATATCATATACCAAA
OB2846 null -41 6.7 GTTGATATATCAGATATCAAC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD