Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IcaR in Staphylococcaceae

Properties
Regulator family: TetR
Regulation mode: repressor
Biological process: Intercellular adhesion
Effector:
Regulog: IcaR - Staphylococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Staphylococcus aureus subsp. aureus N315
SA2459 icaA -29 7.2 ACCTAACTAACGAAAGGTAGGT
SA2458 icaR -156 7.2 ACCTACCTTTCGTTAGTTAGGT
Staphylococcus capitis SK14
STACA0001_0088 icaA -29 7.2 ACCTAACTAACGAAAGGTAGGT
STACA0001_0089 icaR -159 7.2 ACCTACCTTTCGTTAGTTAGGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD