Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BLA_0357 in Bifidobacteriaceae

Properties
Regulator family: ROK
Regulation mode:
Biological process: Galactooligosaccharide utilization
Effector:
Regulog: BLA_0357 - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium longum subsp. infantis ATCC 15697
Blon_2242 BLA_0357 -140 5.8 TTCTAGAAAATTGATTTAAAAAA
Blon_2242 BLA_0357 -182 6.3 TTTTTTAAAGTAAGTTTTCAAAA
Bifidobacterium adolescentis ATCC 15703
BAD_0312 glgX -219 6.2 TTTTGCAAATCTCTTTTCATAAA
Bifidobacterium angulatum DSM 20098
BIFANG_00707 glgX -76 6.2 TTTTGCAAATCTGTTTTCTTAAA
BIFANG_00714 BLA_0357 -91 6 TTTTCGAAAGTAGTTTTGTAAAA
Bifidobacterium animalis subsp. lactis AD011
BLA_0357 BLA_0357 -104 6.5 TTTTGAAAATCAGCTTTGCAAAA
Bifidobacterium bifidum NCIMB 41171
BbifN4_010100007732 BLA_0357 -117 5 TTATATAAAGTATGTTTATAAAA
BbifN4_010100007732 BLA_0357 -75 6 TTTTATAAAATTATTTATTAAAA
Bifidobacterium breve DSM 20213
BIFBRE_00264 BLA_0357 -75 5.2 ATTTCAAAAAGTCTTTTGCTAAA
BIFBRE_00259 glgX -215 6.3 TTTTGCAAATTTCTTTTCATAAA
Bifidobacterium dentium Bd1
BDP_0421 glgX -185 6.3 TTTTGCAAATTTCTTTTCATAAA
BDP_0425 BLA_0357 -72 5.1 TTCTTGAAAACACTTTTCTAAAG
Bifidobacterium gallicum DSM 20093
BIFGAL_00794 BLA_0357 -395 5 TTTTGCAAAGTGAGTTGTGAAAA
Bifidobacterium longum NCC2705
BL1574 BLA_0357 -140 5.5 TTCTAGAAAGTTGGTTTAAAAAA
BL1574 BLA_0357 -182 6.3 TTTTTTAAAGTAAGTTTTCAAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD