Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Crp in Bifidobacteriaceae

Properties
Regulator family: CRP
Regulation mode:
Biological process: Tricarboxylic acid cycle; Energy metabolism
Effector:
Regulog: Crp - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium longum subsp. infantis ATCC 15697
Blon_2241 adh -149 6.4 TATTGTGACTCAGGTCACATAT
Blon_1715 pflB -81 5.1 CAATGTGAGATAGCTCACCCCC
Blon_0840 ldh -183 5.5 TAACGTGATAAACATCACAGTT
Blon_0353 ispD -50 4.8 AGATGTGATGCAGTTCACGGAC
Blon_0136 ilvC2 -170 4.7 TGGCGTGAAATAGCTCACGTTG
Blon_2480 nrdH -209 5.1 AAATGTGAACAATGCCACATGT
Blon_2239 aldB -78 4.9 TATAGTGGTATAGCTCACGTTG
Blon_2322 nox -105 4.8 TAACGTGATCTTCCTCACATTT
Blon_0037 null -290 4.7 CGATGTGAGAAAGCTCACGGTC
Bifidobacterium adolescentis ATCC 15703
BAD_0319 adh -109 5.3 AAGTGTGTCCTAGGTCACAAAA
BAD_0992 pflB -126 5.6 GATTGTGATTTATGTCACTAAT
BAD_1117 ldh -4 5.4 AGCTGTGACGAAAATCACTTTT
Bifidobacterium angulatum DSM 20098
BIFANG_00716 adh -129 5.1 TATTGTGGGGCAGGTCACAGGC
BIFANG_01531 pflB -114 5.9 AAATGTGAGATAGCTCACTTCG
Bifidobacterium animalis subsp. lactis AD011
BLA_0358 adh -76 5.8 GATTGTGAGACAACTCACATCT
BLA_0967 pflB -123 5.7 AAATGTGACCAAGCTCACGCGT
BLA_1484 pta -133 5.2 GAATGTGACCTGCGTCACATTC
Bifidobacterium bifidum NCIMB 41171
BbifN4_010100007737 adh -110 4.9 GATTGTGGCGTAGGCCACAGAT
BbifN4_010100005855 pflB -108 5.4 GAATGTGAGATAAGTCACGCCG
BbifN4_010100002254 ldh -145 5.8 CAATGTGACGCAAATCACCTTG
BbifN4_010100000325 ilvC2 -218 4.7 AATAGTGAGATGGTTCACGTTG
BbifN4_010100007742 aldB 5 4.9 GTTCGTGAGGCAGGTCACAGCG
BbifN4_010100008701 nox -131 4.4 CATCGTGATGTTCGTCACATCC
BbifN4_010100009176 null -242 4.7 CGATGTGAATAAGTTCACGGAT
Bifidobacterium breve DSM 20213
BIFBRE_00269 adh -126 5.6 TATTGTGATGCAGGTCACAGGC
BIFBRE_01106 pflB -113 5.3 GAATGTGAGATAGCTCACTCCC
BIFBRE_01807 ldh -183 5.8 TAACGTGACGAAAATCACATAA
BIFBRE_00201 ispD -50 4.8 AGCTGTGAGGCAGGTCACGAAC
BIFBRE_01899 ilvC2 -171 5.5 AATAGTGACCTAGCTCACGTTG
BIFBRE_00660 nrdH -162 5.2 AAATGTGAACAATGCCACATAT
BIFBRE_00271 aldB -76 4.3 ACACGTGTCATAAATCACGCAC
BIFBRE_00271 aldB -38 4.7 GATTGTGACGTACAGCACTGGG
BIFBRE_00121 nox -66 4.7 AAACGTGACCTTCCTCACAGCT
BIFBRE_01254 null -208 4.6 AACCGTGACGATACTCACATGA
Bifidobacterium dentium Bd1
BDP_0426 adh -109 5.9 GATTGTGACTCAGGTCACAACG
BDP_1376 pflB -126 5.7 ATATGTGAAATAAATCACTTTT
BDP_1558 ldh -143 5.5 AAGTGTGGCGCAAATCACGTTT
Bifidobacterium gallicum DSM 20093
BIFGAL_00796 adh -94 5.3 ATTAGTGAATCAGGTCACATTG
BIFGAL_01295 pflB -116 5.8 AAATGTGACCAAGGTCACGCTG
BIFGAL_01466 pta -283 5.9 GATTGTGACACAGGTCACGTTC
Bifidobacterium longum NCC2705
BL1575 adh -149 5.9 TATTGTGCCTCAGGTCACATAT
BL0951 pflB -75 5.2 CAATGTGAGATAGCTCACTCCC
BL1308 ldh -183 5.4 TAACGTGATAAACATCACAGTA
BL0324 ispD -50 4.8 AGATGTGATGCAGTTCACGGAC
BL0530 ilvC2 -163 5.5 AATAGTGACCTAGCTCACGTTG
BL0668 nrdH -162 5.1 AAATGTGAACAATGCCACATGT
BL1266 nox -105 4.8 TAACGTGATCTTCCTCACATTT
BL0613 null -290 4.4 CGATGTGAGAAAGCTCATAGCT
Gardnerella vaginalis 409-05
HMPREF0424_0254 adh -96 5.8 AATTGTGACTTGTATCACATAT
HMPREF0424_0886 pflB -119 5.3 AAATGTGATATATTTCACTAGA
HMPREF0424_0179 nrdH -232 5 TTTTGTGAAATAAATTACATTT
HMPREF0424_0180 gnd -215 4.8 AAATGTAATTTATTTCACAAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD