Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BL0610 in Bifidobacteriaceae

Properties
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Regulog: BL0610 - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium longum NCC2705
BL0610 null -33 7.1 GATTCTTATCGATAAGGTTC
BL0611 null -48 7.1 GAACCTTATCGATAAGAATC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD