Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GosR2 in Bifidobacteriaceae

Properties
Regulator family: LacI
Regulation mode:
Biological process: Galactooligosaccharide utilization
Effector:
Regulog: GosR2 - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium longum subsp. infantis ATCC 15697
Blon_2416 lacZ5 -165 6.5 GAATTAAATCGGTTTAACGC
Blon_2415 gosR2 -130 6.5 GCGTTAAACCGATTTAATTC
Blon_2414 Blon_2414 -99 6.3 AGATTAAATCGGTTTAAAAC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD