Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BBNG_01789 in Bifidobacteriaceae

Properties
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Regulog: BBNG_01789 - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium bifidum NCIMB 41171
BbifN4_010100009055 BBNG_01789 -260 5.3 CCTTGTAACCGTTTACATCA
BbifN4_010100009055 null -260 5.3 CCTTGTAACCGTTTACATCA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD