Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CldR in Bifidobacteriaceae

Properties
Regulator family: LacI
Regulation mode:
Biological process: Cellodextrin utilization
Effector: Cellobiose
Regulog: CldR - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium dentium Bd1
BDP_0136 cldR -181 4.4 ACGCTGGAATCGTTTCCAAAAG
BDP_0137 cldE -173 5.6 TTGATGGAAACGGTTCCATCAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD