Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BIFBRE_03542 in Bifidobacteriaceae

Properties
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Regulog: BIFBRE_03542 - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium breve DSM 20213
BIFBRE_00875 null -275 6.8 TGCTGAGAACGCTCCCAATA
BIFBRE_00875 null -137 6.8 CACTGGGAGCGCTCCGAAGA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD