Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FruR in Bifidobacteriaceae

Properties
Regulator family: ROK
Regulation mode:
Biological process: Fructose utilization
Effector:
Regulog: FruR - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium longum subsp. infantis ATCC 15697
Blon_0878 fruR -92 7.4 ATTAATTAACAGCGTTAATATCT
Bifidobacterium adolescentis ATCC 15703
BAD_1095 fruR -68 7.1 ATCAATTAACGGCGTTAATATAT
Bifidobacterium angulatum DSM 20098
BIFANG_01659 fruR -75 7.1 TTGTATTAACTGCGTTAATATCT
Bifidobacterium animalis subsp. lactis AD011
BLA_0755 fruR -96 7.3 ATGTATTAACTGCGTTAATATAT
BLA_0755 fruR -79 5.6 ATATATAAACATCGTTAACACAT
Bifidobacterium bifidum NCIMB 41171
BbifN4_010100002369 fruR -103 7.2 TTTGATTAACAGTGTTAATATAT
Bifidobacterium breve DSM 20213
BIFBRE_01709 fruR -91 7 ATAGATTAACTACGTTAATATCT
Bifidobacterium dentium Bd1
BDP_1538 PF07221 -73 6.4 AGTGATTAACATAGTTAATACAT
BDP_1533 fruR -69 6.5 TGACGTTAACAGCGTTAATATAT
Bifidobacterium gallicum DSM 20093
BIFGAL_01109 fruK -211 7.3 ATTGATTAACTGTGTTAATATAT
Bifidobacterium longum NCC2705
BL1340 fruR -92 7.3 ATCAATTAACAGCGTTAATATCT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD