Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GntR in Bifidobacteriaceae

Properties
Regulator family: LacI
Regulation mode:
Biological process: Gluconate utilization
Effector: Gluconate
Regulog: GntR - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium dentium Bd1
BDP_1686 gntR -177 7.4 TAGGTGTATCGATACCCCTA
BDP_1687 idnO -91 7.4 TAGGGGTATCGATACACCTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD