Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BL0176 in Bifidobacteriaceae

Properties
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Regulog: BL0176 - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium adolescentis ATCC 15703
BAD_1525 nagA -92 6.5 TATATGTAACGATACATATA
BAD_1526 null -148 6.5 TATATGTATCGTTACATATA
Bifidobacterium dentium Bd1
BDP_2092 nagA -157 6.8 AATATGTACCGTTACATATA
BDP_2093 null -175 6.8 TATATGTAACGGTACATATT
Bifidobacterium longum NCC2705
BL0181 abfA -197 5.7 AATATGTAACGGTACGTGTG
BL0181 abfA -75 6.8 AATATGTACCGTTACATATT
BL0176 null -210 6.4 CGTATGTACCGTTACATATT
BL0177 nagA -183 6.4 AATATGTAACGGTACATACG
BL0174 PF07944 -55 6.2 CATATGTGCCGATACATATT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD