Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GlxR in Bifidobacteriaceae

Properties
Regulator family: LacI
Regulation mode:
Biological process: Glycerate utilization
Effector: D-glycerate
Regulog: GlxR - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium longum NCC2705
BL0846 glxR -158 6.9 AACGGTAAACGTTTTCCGTA
BL0845 glxK 42 6.9 TACGGAAAACGTTTACCGTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD