Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Staphylococcaceae

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Staphylococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Staphylococcus aureus subsp. aureus N315
SA1411 hrcA -38 6.8 TTAGCACTTGAGATAAGTGAGTGCTAA
SA1837 groES -54 6.9 TTAGCACTCTTTAATGTTAAGTGCTAA
Staphylococcus capitis SK14
STACA0001_1890 hrcA -40 7 TTAGCACTTGAGAGAAAAGAGTGCTAA
STACA0001_1993 groES -54 7.2 TTAGCACTCTAATAATTAAAGTGCTAA
Staphylococcus epidermidis ATCC 12228
SE1630 groES -54 7.1 TTAGCACTCTATATATCAAAGTGCTAA
SE1269 hrcA -38 7.2 TTAGCACTTGAGATAAAAGAGTGCTAA
Staphylococcus carnosus subsp. carnosus TM300
Sca_1204 hrcA -38 6.8 TTAGCACTTGAGAGAAGAGAGTGCTAA
Sca_1541 groES -98 7.6 TTAGCACTCAATAATCAAGAGTGCTAA
Staphylococcus haemolyticus JCSC1435
SH1001 groES -55 7 TTAGCACTCATTATATTTAAGTGCTAA
SH1334 hrcA -40 6.9 TTAGCACTTAGGACAAAAGAGTGCTAA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
SSP0847 groES -56 7 TTAGCACTCATTAACTTAAAGTGCTAA
SSP1175 hrcA -40 7 TTAGCACTTGAAACAAAAGAGTGCTAA
Macrococcus caseolyticus JCSC5402
MCCL_1234 hrcA -37 6.9 TTAGCACTTGAGGTGATAGAGTGCTAA
MCCL_1711 groES -61 7.1 TTAGCACTATATATAAGAGAGTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD