Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FucR in Bifidobacteriaceae

Properties
Regulator family: LacI
Regulation mode:
Biological process: Fucose utilization
Effector: Fucose
Regulog: FucR - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium longum subsp. infantis ATCC 15697
Blon_2309 fucD -87 5.3 AAAAATTTTCGTAATCGGGT
Blon_2310 fucR -112 5.3 ACCCGATTACGAAAATTTTT
Bifidobacterium breve DSM 20213
BIFBRE_00138 fucD -88 5 AAAAATTTTCGCAAATAGGC
BIFBRE_00139 fucR 79 5 GCCTATTTGCGAAAATTTTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD