Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BDP_2111 in Bifidobacteriaceae

Properties
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Regulog: BDP_2111 - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium breve DSM 20213
BIFBRE_02141 BIFBRE_02141 -81 6.2 TTATCTTAACGATACGATAT
Bifidobacterium dentium Bd1
BDP_2111 BDP_2111 -95 6.2 TAATCGCAACGATTCGATTT
BDP_2111 BDP_2111 -215 5.7 GAATCGCAACGATTCGATTA
BDP_2110 BDP_2110 -145 5.7 TAATCGAATCGTTGCGATTC
BDP_2110 BDP_2110 -265 6.2 AAATCGAATCGTTGCGATTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD