Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BDP_2100 in Bifidobacteriaceae

Properties
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Regulog: BDP_2100 - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium breve DSM 20213
BIFBRE_00641 null -22 6.7 AAAAATAAACGTTTAGGATT
Bifidobacterium dentium Bd1
BDP_2100 null -86 4.6 CATGCTAAACGTTTGTGATA
BDP_2100 null -57 6.5 CATCACAAACGTTTAGCAAA
BDP_2099 null -46 7 GAAAATAAACGTTTAGCATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD