Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BfrR in Bifidobacteriaceae

Properties
Regulator family: LacI
Regulation mode:
Biological process: Fructooligosaccharides utilization
Effector:
Regulog: BfrR - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium longum subsp. infantis ATCC 15697
Blon_2061 bfrB -156 5.9 TGAGATAAACGATTAACATT
Blon_2061 bfrB -135 4.9 GACATTAATCGATTAACGTC
Bifidobacterium adolescentis ATCC 15703
BAD_1330 bfrB -141 6 TGAGATAAACGATTAACGTT
BAD_1330 bfrB -120 4.9 GACATTAAACGATTAACGAT
Bifidobacterium angulatum DSM 20098
BIFANG_00830 bfrB -140 5.6 TGGAATAATCGTTTAACGTT
BIFANG_00830 bfrB -119 4.9 GACATTAAACGATTAACGAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD