Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AraQ in Bifidobacteriaceae

Properties
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Effector:
Regulog: AraQ - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium longum subsp. infantis ATCC 15697
Blon_0423 araQ -110 5.5 CAGTGTGAGCGCTAACGCAA
Blon_2246 malQ1 -110 6.1 CATTGTGAGCGCTCACATCT
Blon_1745 pyk -127 6.1 CAATGTGAGCGCTCACAACA
Blon_2246 malQ1 -88 4.6 CTGTGTGAGGGCTAAAAGTA
Blon_1096 tkt -156 5.3 CACTGTGAACGTTAACAGAA
Blon_0896 galM -43 5.4 GATTGTGAGCGGTAACAATC
Blon_1761 glgB -108 5.3 CTATGAGAGCGCTCACAACC
Blon_2444 malE -227 5.1 ATATGTTAGCGCTCTCATGA
Blon_2289 null -144 4.9 CCGTGTTAACGTTCACAACT
Blon_2288 null -107 4.9 AGTTGTGAACGTTAACACGG
Blon_0840 ldh -160 5.3 GTTTGGGAGCGCTAACAACC
Blon_1836 eno -108 6 CATTGTGAGCGCTAACACTA
Blon_0900 gap -155 6.3 AATTGTGAGCGCTCACAAAA
Bifidobacterium adolescentis ATCC 15703
BAD_1079 gap -156 5.1 GCATGTGAGCGTTCACTGAA
BAD_1413 araQ -75 5.4 GGTTGTTAGCGCTAACTGAA
BAD_0431 maa -20 5.4 TGGTGTGAGCGTTCACTATA
BAD_1529 PF07944 -49 5.5 GATTGTGAGCGTTAACAAGA
BAD_0829 tkt -156 6.1 AATTGTGAGCGCTAACAGCA
BAD_1082 galM -57 5 CATCGTGAGCGGTAACATAG
BAD_0678 pyk -51 6.3 AATTGTGAGCGCTCACAACA
BAD_1117 ldh -23 6.2 GTATGTGAGCGCTCACAAAA
BAD_0645 eno -106 5.3 GAGTGTGAGCGTTCACATGG
BAD_1412 araB -82 5.3 AATAGTGAGCGTTAACAGTG
BAD_1412 araB -69 5.5 AACAGTGAGCGCTAACATTC
Bifidobacterium angulatum DSM 20098
BIFANG_00987 ldh -102 4.7 CGATGTGAGCGCTGCCAGTG
BIFANG_00188 araE -347 5.3 TTTTGAGAGCGTTCACATCA
BIFANG_01141 pyk -131 6.1 AATTGTTAGCGCTCACATAA
BIFANG_01436 tkt -166 4.7 AAACGAGAACGCTAACAGAA
BIFANG_01641 galM -51 5.1 ATGTGTTAGCGGTAACAACC
BIFANG_00188 araE -176 5.4 AAATGTGAGCGATAACATTT
Bifidobacterium animalis subsp. lactis AD011
BLA_1494 pyk -380 6 GGTTGTGAGCGCTCACAGAC
BLA_1030 eno -104 5.2 TCGTGGGAGCGCTCACATTT
BLA_0056 araB -70 5.9 TTGTGTGAGCGCTAACATAT
BLA_0056 araB -213 5 TCATGTTACCGCTCACAAGA
Bifidobacterium bifidum NCIMB 41171
BbifN4_010100004774 tkt -159 5.8 ACTTGTGAGCGCTAACATAA
BbifN4_010100001337 gatC -238 5.5 ATATGTGAGCGCTCCCAATT
BbifN4_010100003349 pyk -131 6.1 AGATGTGAGCGCTCACAACA
BbifN4_010100002254 ldh -163 5.8 GTCTGTGAGCGTTCACAACA
BbifN4_010100003174 eno -105 5.3 GAATGTTAGCGCTCATATTA
BbifN4_010100001372 araQ -122 5.4 ATCTGTGAGCGCTCACGCGT
BbifN4_010100002474 galM -44 4.5 GATAGCGAGCGGTAACAATA
BbifN4_010100001332 sgaR -130 5.5 AATTGGGAGCGCTCACATAT
BbifN4_010100002494 gap -155 5.3 ATTTGTTAGCGTTAACGGAA
Bifidobacterium breve DSM 20213
BIFBRE_01690 gap -155 6.2 CAATGTGAGCGCTCACAAAA
BIFBRE_01051 pyk -77 6 CAGTGTGAGCGCTCACAACA
BIFBRE_01332 tkt -156 5.8 AATTGTGAACGCTAACAGAA
BIFBRE_01694 galM -44 4.9 GATTGCGAGCGGTAACAATA
BIFBRE_01039 glgB -108 5.4 CAATGAGAGCGCTCACAATC
BIFBRE_00012 malE -229 4.9 GCATGTTAGCGCTCTCATTG
BIFBRE_00165 null -213 5.2 CGGTGTGAACGCTCACACGT
BIFBRE_00166 null -107 5.2 ACGTGTGAGCGTTCACACCG
BIFBRE_01807 ldh -160 5.9 GGCTGTGAGCGCTAACAACT
BIFBRE_01016 eno -108 6.1 CATTGTGAGCGCTCACATCA
BIFBRE_02212 araQ -146 5.4 CAATGTGAGCGCTCACGCGA
Bifidobacterium dentium Bd1
BDP_1924 araB -81 5.3 AATAGTGAGCGTTAACAGTG
BDP_1558 ldh -162 6.1 GTTTGTGAGCGCTCACATCA
BDP_0569 maa -49 5.5 TTGCGTGAACGCTCACAACA
BDP_1145 tkt -157 5.7 CATTGTGAACGCTAACAGAA
BDP_1518 galM -56 4.8 GACCGTTAGCGGTAACAACC
BDP_1926 araQ -75 5.1 GCCTGTTAGCGCTAACTGAA
BDP_0870 eno -106 5.5 GTATGTGAGCGTTCACATGA
BDP_1514 gap -156 5.5 CATTGTGAGCGTTCACGGAA
BDP_1924 araB -68 5.5 AACAGTGAGCGCTAACATTC
BDP_0904 pyk -126 6.2 AAATGTGAGCGCTCACAACA
Bifidobacterium gallicum DSM 20093
BIFGAL_00353 pyk -125 5.5 CTATGTTAACGCTAACAACA
BIFGAL_01223 eno -104 4.5 ACATGTGAACACTCACTGCA
BIFGAL_00651 araB -2 5.7 AAATGTTAGCGCTAACATAC
Bifidobacterium longum NCC2705
BL1363 gap -155 6.2 AATTGTGAGCGCTCACAGAA
BL0988 pyk -40 6.1 CAATGTGAGCGCTCACAACA
BL1570 malQ1 -110 6.1 CATTGTGAGCGCTCACATCT
BL0716 tkt -156 5.6 CACTGTGAACGCTAACAGAA
BL1359 galM -43 5.4 GATTGTGAGCGATAACAATT
BL0999 glgB -147 5.3 CTATGAGAGCGCTCACAACC
BL0141 malE -246 5.4 ATATGTTAGCGCTCTCATAA
BL1532 null -123 5 CCATGTTAACGTTCACAACT
BL1533 null -45 5 AGTTGTGAACGTTAACATGG
BL0275 araQ -71 5.5 CAGTGTGAGCGCTAACGCAA
BL1308 ldh -160 5.7 ATTCGTGAGCGCTAACAACC
BL0274 araB -70 5.8 AATTGTGAGCGCTAACACCC
BL1022 eno -108 5.6 CATTGTGAGCGCTAACGCTA
Gardnerella vaginalis 409-05
HMPREF0424_0607 pyk -146 6 TTCTGTGAGCGTTCACAAAA
HMPREF0424_0662 eno -106 5.3 TATTGTGAACGTTCACGGCA
HMPREF0424_0471 gap -161 4.9 GCATGTTAACGCTCACTGTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD